Skip to main content

Table 3 Primer sequences and conditions for pyrosequencing analysis

From: Hypermethylation of CDKN2A exon 2 in tumor, tumor-adjacent and tumor-distant tissues from breast cancer patients

Gene Primer sequence Primer concentration [nM] Ta [°C] Amplicon length [bp] No. of CpGs analyzed Chromosome, position of sequence to analyze, DNA strand Reference
ESR2 f: 5′ GGAGGTTGAGAGAAATAATTGTTTTTTGA 3′ 400 61 255 9 14,
[49,292-
49,369],
positive strand
in-house [NG_011535.1]
r: 5′ [Btn]ATAAACACACCCACCTTACCTTCTCTA 3′
s: 5′ GAAATAATTGTTTTTTGAAATTTG 3′
   
  1. f forward primer, r reverse primer, s sequencing primer, [Btn] biotin, T a annealing temperature