Hypermethylation of CDKN2A exon 2 in tumor, tumor-adjacent and tumor-distant tissues from breast cancer patients

Table 3 Primer sequences and conditions for pyrosequencing analysis

Gene	Primer sequence	Primer concentration [nM]	T_a [°C]	Amplicon length [bp]	No. of CpGs analyzed	Chromosome, position of sequence to analyze, DNA strand	Reference
ESR2	f: 5′ GGAGGTTGAGAGAAATAATTGTTTTTTGA 3′	400	61	255	9	14, [49,292- 49,369], positive strand	in-house [NG_011535.1]
ESR2	r: 5′ [Btn]ATAAACACACCCACCTTACCTTCTCTA 3′ s: 5′ GAAATAATTGTTTTTTGAAATTTG 3′				9	14, [49,292- 49,369], positive strand	in-house [NG_011535.1]

f forward primer, r reverse primer, s sequencing primer, [Btn] biotin, T _a annealing temperature

ISSN: 1471-2407