Skip to main content

Table 2 The sequences of the primers for PCR used in this study

From: Keratin 19 as a key molecule in progression of human hepatocellular carcinomas through invasion and angiogenesis

Gene Sequences (5’-3’)
Actin ATGGGTCAGAAGGATTCCTATGT
GAAGGTCTCAAACATGATCTGGG
K19 TACAGCCACTACTACACGACCATC
AGAGCCTGTTCCGTCTCAAACT
E-cadherin CAGCGTGTGTGACTGTGAAGG
CAGCAAGAGCAGCAGAATCAGAA
vimentin TGGCCGACGCCATCAACACC
CACCTCGACGCGGGCTTTGT
p16 GCTTCCTGGACACGCTGGT
CGGGCATGGTTACTGCCTCTG
p27 CCGGCTAACTCTGAGGACAC
TTGCAGGTCGCTTCCTTATT
N-cadherin ACGCCGAGCCCCAGTATC
GGTCATTGTCAGCCGCTTTAAG
snail CCTGCGTCTGCGGAACCT
TTGGAGCGGTCAGCGAAGG
vasohibin-1 (VASH1) ACATGCGGCTCAAGATTGGC
TCACCCGAGGGCCGTCTT
vasohibin-2 (VASH2) CAGGGACATGAGAATGAAGATCCT
CAGGCAGTGCAGGCGACT
FGFR1 GCCTGAACAAGATGCTCTCC
CAATATGGAGCTACGGGCAT
  1. Abbreviations: K keratin, FGFR fibroblast growth factor