Skip to main content

Table 1 Quantitative real-time PCR primers

From: Increased Wnt5a in squamous cell lung carcinoma inhibits endothelial cell motility

Primers Forward Reverse
beta-actin GCGCGGCTACAGCTTCA CTTAATGTCACGCACGATTTCC
PPARgamma GCTTTTGGCATACTCTGTGATCTC GGTGGCCATCCGCATCT
VEGF-A GGGCAGAATCATCACGAAGT TGGTGATGTTGGACTCCTCA
CD105 CTCTCCAGGCATCCAAGCAA CAGGCTGGAATTGTAGGCCA
CD31 GCTGACCCTTCTGCTCTGTT ATCTGGTGCTGAGGCTTGAC
HIF-1alpha GCCAGACGATCATGCAGCTA ATCCATTGATTGCCCCAGC
IL-1beta TCAGCCAATCTTCATTGCTCAA TGGCGAGCTCAGGTACTTCTG
Wnt5a CAAAGCAACTCCTGGGCTTA CCTGCTCCTGACCGTCC