Skip to main content

Table 2 Methylation specific PCR primer sequences

From: Salivary DNA methylation panel to diagnose HPV-positive and HPV-negative head and neck cancers

Gene Nucleotide sequence PCR product size, base pair (bp)
Methylation-independent primer sequences (nested)
RASSF1α Forward: 5′-GGAGGGAAGGAAGGGTAAGG-3′ 260
Reverse: 5′-CAACTCAATAAACTCAAACTCCC-3′
p16INK4a Forward: 5′-GAGGAAGAAAGAGGAGGGGTTG-3′ 274
Reverse: 5′-ACAAACCCTCTACCCACCTAAATC-3′
Methylated allele-specific primer sequences
RASSF1α Forward: 5′-GGGGGTTTTGCGAGAGCGC-3′ 203
Reverse: 5′-CCCGATTAAACCCGTACTTCG-3′
p16INK4a Forward: 5′-GAGGGTGGGGCGGATCGC-3′ 143
Reverse: 5′-GACCCCGAACCGCGACCG-3′
TIMP3 Forward: 5′-GCGTCGGAGGTTAAGGTTGTT-3′ 116
Reverse: 5′-CTCTCCAAAATTACCGTACGCG-3′
PCQAP 5′ Forward: 5′-GTTTTGTGATTGAGGYGGCGGC -3′ 167
Reverse: 5′-AAAAATCCCACAATCCAACCC -3′
PCQAP 3′ Forward: 5′-GATATGGGTGGTGGGAGTTGGG -3′ 172
Reverse: 5′- AATCAGACCCTAACCTCGCCCG -3′
Unmethylated allele-specific primer sequences
RASSF1α Forward: 5′-GGTTTTGTGAGAGTGTGTTTAG-3′ 172
Reverse: 5′-ACACTAACAAACACAAACCAAAC-3′
p16INK4a Forward: 5′-TTATTAGAGGGTGGGGTGGATTGT-3′ 145
Reverse: 5′-CAACCCCAAACCACAACCATAA-3′
TIMP3 Forward: 5′-TGTGTTGGAGGTTAAGGTTGTTTT-3′ 122
Reverse: 5′-ACTCTCCAAAATTACCATACACACC-3′
PCQAP 5′ Forward: 5′-GTTTTGTGATTGAGGYGGTGGT -3′ 167
Reverse: 5′-AAAAATCCCACAATCCAACCC -3′
PCQAP 3′ Forward: 5′- TGATTAATTTAGATTGGGTTTAGAGAA -3′ 158
Reverse: 5′- CCAACTCCAAATCCCCTCTCTAT -3′