Skip to main content

Table 2 Primer sets used for amplifying the fragment of lncRNA transcripts and control

From: Long non-coding RNA MALAT-1 modulates metastatic potential of tongue squamous cell carcinomas partially through the regulation of small proline rich proteins

  Forward(5′–3′) Reverse(5′–3′)
MALAT1 GGATCCTAGACCAGCATGCC AAAGGTTACCATAAGTAAGTTCCAGAAAA
SPRR2A GGATATTTGGCTCACCTCGT GGAGAAAGAAGCTCCCTGTG
SPRR2D CTGTAGTACACATCACTTGTGGC ACTTGCATCCCAGGACAGAT
SPRR2E CACAGCTTCACCTGCATCTT CAATATGGCAGCCTCAGAAA
SPRR1B GGCCACCAGATGCTGAAT CAGAATGCTAATTGCAAGGC
ACTB GAGCACAGAGCCTCGCCTTT TCATCATCCATGGTGAGCTGGC