Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers and SiRNA sequences used in this study

From: Bifidobacterial recombinant thymidine kinase-ganciclovir gene therapy system induces FasL and TNFR2 mediated antitumor apoptosis in solid tumors

Name Sequence
GAPDH sense
antisense
Acinus sense
Acinus antisense
CAD sense
CAD antisense
ROCK-1 sense
ROCK-1 antisense
TK sense
TK antisense
Bim394 sense
Bim394 antisence
Bid77 sense
Bid77 antisense
a NC sense
a NC antisence
5´ ACCACAGTCCATGCCATCAC 3´
5´ TCCACCACCCTGTTGCTGTA 3´
5´ AGGTGAGGAGAAGGAGGAAGT 3´
5´ TCTACTGACACCTGGGGAGG 3´
5´ CAGCCTCTATGCCAGTCTCG 3´
5´ CTAGCTGCTCCAGGATGCTC 3´
5´ GAATGTGACTGGTGGTCGGT 3´
5´ CTGGTGCTACAGTGTCTCGG 3´
5´CGCATGGATCCCATGGCTTCGTACCCCTGC 3´
5´ ACGCGTCGACTCAGTTAGCCTCCCCCATC 3´
5´ GGUCAUUGGUGAUUAAAUATT 3´
5´ UAUUUAAUCACCAAUGACCTT 3´
5´ GGGAUGAGUGCAUCACAAATT 3´
5´ UUUGUGAUGCACUCAUCCCTT 3´
5´ UUCUCCGAACGUGUCACGUTT 3´
5´ ACGUGACACGUUCGGAGAATT 3´
  1. aNC negative control
  2. The italic primers are SiRNA sequences