Skip to main content

Table 1 Shows the sequences of microsatellite markers used in the study

From: Microsatellite alteration and immunohistochemical expression profile of chromosome 9p21 in patients with sporadic renal cell carcinoma following surgical resection

Primers Sequence
D9S916 Forward 5’- gatgtccagttgtcccttcataa -3’
Reverse 5’- atagactgccaaatttttggacc -3’
D9S974 Forward 5’- cctggtctggatcataaaatgaa -3’
Reverse 5’- tgtggaaattttctgtctggttc -3’
D9S942 Forward 5’- aagcaagattccaaacagtaaaca -3’
Reverse 5’- ttcgtttcacttttgagttttcc -3’
D9S1814 Forward 5’- tgtcagtggtatttacctttttgg -3’
Reverse 5’- cagaaggtcagtaggttcacagg -3’
D9S171 Forward 5’- agctaagtgaacctcatctctg -3’
Reverse 5’- tgattgttaataaagtagcccc -3’