Skip to main content

Table 1 Detailed primers used to access the protein degradation and synthesis processes in placenta tissue

From: Dietary leucine supplementation minimises tumour-induced damage in placental tissues of pregnant, tumour-bearing rats

Protein degradation -associated
Gene Forward Reverse
PC5 NM_053590.1 GGACTTGATGAAGAAGGAAAGG GATGCCCTCTTTGGTCACTATG
PC2 NM_017278.1 CAGGAGTGTTTGGATTCCAG GTTAGCAGATGGACAGGTTTGG
Murf-1 NM_080903 TGAAGTGATCATGGACCGGC AATGCTCTTGATGAGCGGCTT
Atrogin NM_133521 ATGCCGTTCCTTGGTCAGG ATGGCGCTCCTTAGTACTCCC
Ubiquitin NM_031138.2 GAGGCTCATGCGGGATTTCAAG TCCTGATAAAGCTGTGCTGC
Calpain AB384822.1 GAACCGCATCCGGAATTACCTG GGTTGCAGCTGACCATGTTTGCA
Protein synthesis-associated genes
mTOR NM_001134499.2 CTCGTGAAGGACAACGGTCA TAGAGTTTTTCGTGGGCGCT
p70S6K1 NM_031985 GGCCCTGGGGATGCTGGAGA GGCTGACAGGCGTTCGTGGG
eIF4E NM_053974 ACCCCTACCACTAATCCCCC GCTTCAGTGCAGTCCACTCT
eIF4G NM_013507.3 ACCCACAATGGGACGTCATC CCGAGGTGGCATATCCTTCG
4EBP1 NM_053857.2 CGGCACGCTCTTCAGCACCA ACACCCAGTGTCTGCCGGGT
eIF5 XM_001479599.1 TGTCTGTCAACGTCAACCGCAG GAGGCATGCTTGACACACATC
eIF2α AK312442.1 GATCCATTGCTGAAATGGGG GATGACAAGTACAAGAGACCTGG