Skip to main content

Advertisement

Table 1 Specific primers used in qPCR

From: Fusion with stem cell makes the hepatocellular carcinoma cells similar to liver tumor-initiating cells

Gene Forward primer (5’-3’) Reverse Primer (5’-3’)
AFP AGACTGAAAACCCTCTTGAATGC GTCCTCACTGAGTTGGCAACA
CD133 ACATGAAAAG ACCTGGGGG GATCTGGTGTCCCAGCATG
CD44 TCCCAGACGAAGACAGTCCCTGGAT CACTGGGGTGGAATGTGTCTTGGTC
ALDH1A1 CTGCTGGCGACAATGGAGT CTGCTGGCGACAATGGAGT
ABCB1 GGGAGCTTAACACCCGACTTA GCCAAAATCACAAGGGTTAGCTT
EpCAM AATCGTCAATGCCAGTGTACTT TCTCATCGCAGTCAGGATCATAA
Bcl-2 GACTGAATCGGAGATGGAGACC GCAGTTCAAACTCGTCGCCT
β-actin CATCCTCACCCTGAAGTACCC AGCCTGGATAGCAACGTACATG