Skip to main content

Advertisement

Table 1 Primers used for MSP

From: Gene methylation profile of gastric cancerous tissue according to tumor site in the stomach

Primer name Forward sequence Reverse sequence Reference number
MLH1 methylated TATATCGTTCGTAGTATTC [GenBank:NG_0071092] TCCGACCCGAATAAACC [40]
MLH1 unmethylated TTTTGATGTAGATGTTTTATTAGGGT [GenBank:NG_0071092] TACCACCTCATCATAACTACC [40]
MGMT methylated TTTCGACGTTCGTAGGTTTTCGC [GenBank:NG_000010.11] GCACTCTTCCGAAAACGAAAC G [40]
MGMT unmethylated TTTGTGTTTTGATGTTTGTAGGTTTTTGT [GenBank:NG_000010.11] AACTCCACACTCTTCCAAAAACAAAACA [40]
DAPK-1 methylated GGATAGTCGGATCGAGTTAACGTC [GenBank:NG_029883.1] CCCTCCCAAACGCCG A [40]
DAPK-1 unmethylated GGAGGATAGTTGGATTGAGTTAATGTT [GenBank:NG_029883.1] CAAATCCCTCCCAAACACCAA [40]
  1. bp base pairs