Skip to main content

Table 1 RT-PCR Primers

From: RUNX1-Evi-1 fusion gene inhibited differentiation and apoptosis in myelopoiesis: an in vivo study

Name Forward primer Reverse primer Product (bp)
RUNX1-Evi-1 ATATCGCTGCGAAGACTGTGACCA TGAAGGTTGCTAGGGTCCGTGAAA 381
scl GAACAGTATGGGATGTATCCTAGC CGTTGAGGAGCTTAGCCAGA 265
lmo2 ACACTGGAGGCAAATGAGGAG AGTAAAGCCTGCGTCCCACC 193
gata2 CTGCCAGACAACCACGACC CCAGATCGTTTACTCCTCTTGG 180
gata1 CCATCGTATTATTCCACCAGC GGATGTGGGGTTGTAGGGAG 159
pu.1 TCCCAGCAGTCGTAGTCCTC CCATTTCGCAGAAGGTCAA 141
mpo GGGTTGACCACGATCTGACT CAGGGAGACAGGTGTTAGGG 159
c-myb GGCAGAAAGTCCTCAACCC ATCGGTTTCCAAGTTTCTCG 252
runx1 TGGGACGCCAAATACGAAC AGGACGGAGCAGAGGAAGTT 227
P21 GAACGATGTGCTGCACTCCC TGTCAATAACGCTGCTACGAGAC 236
P27 CGACTGTAGGGTAACGGAGCA GGGTGTCGGACTCAATGGTT 178
P53 CGGCGATCATGGATTTAGGC TTCAGCCACATGCTCGGACT 202
ras GTCCACGATGAATCCCGAATA TCTCCTGCCCTGCTGTATCC 212
Bax ACAGGGATGCTGAAGTGACC GAAAAGCGCCACAACTCTTC 236
Bcl2 AACGCGAATTTGAGGAAATG TATCTACCTGGGACGCCATC 189
JNK AACAGGAATAAGCGCGAGAA TTGTGGTTGACGCATTTCAT 245
JUN AAACAGCGCTTTCTCTCAGC TGATCATGCCGTTGCTAGAC 221
skp2 ATCTGGGACTGAGCCGTTGT GAGAACGGCTGCGTGTTGAT 166
Caspas3 AGGCTTGTCGAGGAACAGAA CATGATCTGCAAGAGCTCCA 233
smad7 GGTTCTGTGCCTGCTTCCA TGCCCTGAGGTAGGTCGTAGA 202
smad4 AGACCTCCACATACCACCACA GTCCATCTCGAAGTAGGCAAT 221
β-actin CCTGACCGAGAGAGGCTACA CGCAAGATTCCATACCCAAG 242