Skip to main content

Advertisement

Table 2 Sequences of primers

From: Incarvine C suppresses proliferation and vasculogenic mimicry of hepatocellular carcinoma cells via targeting ROCK inhibition

Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) Size
VE-cadherin CATTTGTCGTGCCTGAAGAC ATGGTGAAAGCGTCCTGGTA 133
EphA2 CCCGGAGGACGTTTACTTCT GGATGGATGGATCTCGGTAG 124
PI3K CGTTTCTGCTTTGGGACAAC CCTGATGATGGTCGTGGAG 100
MMP14 TATGGCTTCTGCCCTGAGAC GGGTTTCTTCTGCCCACTT 120
MMP2 TATGGCTTCTGCCCTGAGAC CACACCACATCTTTCCGTCA 142
MMP9 CAGTCCACCCTTGTGCTCTT ACTCTCCACGCATCTCTGC 118
LAMC2 ACATTCCTGCCTCAGACCAC TCCCTTGTCAGTTGCTCCAT 121
  1. All the sequences are based on the published data on the National Center for Biotechnology Information followed by the accession number