Skip to main content

Advertisement

Table 1 Sequences of primers

From: Incarvine C suppresses proliferation and vasculogenic mimicry of hepatocellular carcinoma cells via targeting ROCK inhibition

Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) Size
CDK-2 TACTTCTATGCCTGATTACA TGGGGTACTGGCTTGGTCAC 199
CDK-4 GCTACCAGATGGCACTTACACC GCAAAGATACAGCCAACACTCC 118
CDK-6 GCCCACTGAAACCATAAAGGA TACCACAGCGTGACGACCA 204
Cynlin-A1 TGTCACCGTTCCTCCTTGG GGGCATCTTCACGCTCTATTT 125
Cynlin-B1 GCTCTTGGGGACATTGGTAAC CAAAATAGGCTCAGGCGAAA 234
Cynlin-C1 TTGATTGCTGCTGCTACTTCTG CGTTCTGTAGGTATCATTCACT 237
Cynlin-D1 GGAACAGAAGTGCGAGGAGG GGATGGAGTTGTCGGTGTAGAT 191
Cynlin-E1 CCTGGATGTTGACTGCCTTGA TGTCGCACCACTGATACCCT 113
p21 GACACCACTGGAGGGTGACT CACATGGTCTTCCTCTGCTG 166
p27 TAGAGGGCAAGTACGAGTGG CAGGTCGCTTCCTTATTCC 258
P53 GTTCCGAGAGCTGAATGAGG TGAGTCAGGCCCTTCTGTCT 157
  1. All the sequences are based on the published data on the National Center for Biotechnology Information followed by the accession number