Skip to main content

Table 1 Oligo sequences

From: The NF-κB p65 and p50 homodimer cooperate with IRF8 to activate iNOS transcription

Oligo Name Use Forward Reverse
hiNOS RT-PCR 5'- ACATCACCACACCCCCAACC -3' 5'- GAAAGCAGGAAGCCAGCAGAC -3'
hICSBP (IRF8) RT-PCR 5'-CCAGATTTTGAGGAAGTGACGGAC-3' 5'-TGGGAGAATGCTGAATGGTGC-3'
hβ-actin RT-PCR 5'- GGAACGGTGAAGGTGACAGCAG -3' 5'- TGTGGACTTGGGAGAGGACTGG -3'
hiNOS-ChIP1 Chromatin immunoprecipitation 5'- CCACAGGTCAAGAATGCCACAC -3' 5'- AATGCCCCCACCCAAGAGCC -3'
hiNOS-ChIP2 Chromatin immunoprecipitation 5'- ACTCCTAATCATCCCTCAAAACCC -3' 5'- CATCTGCCACGAAGAGCAATG -3'
hiNOS-ChIP3 Chromatin immunoprecipitation 5'- GGACTTGGGACCAGAAAGAGGTG -3' 5'- GCCATCCAGAGAGTTGTTTTTGC -3'
hiNOS-ChIP4 Chromatin immunoprecipitation 5'- GGTCTCTTCCTGGTTTGACTGTCC -3' 5'- TTCCAACACCTTCTCTCTGTAGGC -3'
hiNOSNF-κB Probe EMSA 5'-AAAATTGTGGGAATTTTCTGCCTAC-3' 5'-GTAGGCAGAAAATTCCCACAATTTT-3'
NFB WT Probe EMSA 5'-CGGGAATTCCC-3' 5'-GGGAATTCCCG-3'
miNOS RT-PCR 5'-CCAGAGGACCCAGAGACAAGC-3' 5'-GGCAGCACATCAAAGCGGC-3'
mβ-actin RT-PCR 5'-CTGGCACCACACCTTCTACAATG-3' 5'-GGGTCATCTTTTCACGGTTGG-3'
miNOSChIP1 Chromatin immunoprecipitation 5'-ATGGTGTCTTCTGCCTCGCAAG-3' 5'-CCCCAGGATTCCACTGTTGAAC-3'
miNOSChIP2 Chromatin immunoprecipitation 5'-AAAGGAGAAACAGCCACCAAGC-3' 5'-AGCACCCACAACCCAAAGAAC-3'
miNOSChIP3 Chromatin immunoprecipitation 5'-TCCATCCCCTGAGCAATGTG-3' 5'-CCCCCCAAACCCAATACTTG-3'
miNOSChIP4 Chromatin immunoprecipitation 5'-CACAGCCCATCCACTATTCTGC-3' 5'-CCAGGACACATTCATCAGGAGG-3'
miNOSChIP5 Chromatin immunoprecipitation 5'-ACTCAGGGTAGGGTCCAGTTCATC-3' 5'-TATGTGGCTTCTCCTTGGCGAG-3'
miNOSNF-κB Probe EMSA 5'-GCTAGGGGGATTTTCCCTCTCTC-3' 5'-GAGAGAGGGAAAATCCCCCTAGC-3'