Skip to main content

Advertisement

Table 3 Real-time qPCR primers

From: Small nucleolar RNA U91 is a new internal control for accurate microRNAs quantification in pancreatic cancer

Primer name Primer sequence
Universal primer ATCCAGTGCAGGGTCCGAGG
mir-39 C. elegance GCGGCGGAGCTGATTTCGTCTTG
U6 GCGGCGGCGCAAGGATGACACG
U91 snoRNA GCGGCGGTGGCCGATGATGACG
miR-16 GCGGCGGTAGCAGCACGTAAAT
mir-21 GCGGCGGTAGCTTATCAGACTG
miR-96 GCGGCGGTTTGGCACTAGCAC
miR-148a GCGGCGGAAAGTTCTGAGACACTCC
miR-155 GCGGCGGTTAATGCTAATCGTG
miR-196a GCGGCGGTAGGTAGTTTCATGTTG
miR-217 GCGGCGGTACTGCATCAGGAAC