Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Stem-loop primers for the miRNAs

From: Small nucleolar RNA U91 is a new internal control for accurate microRNAs quantification in pancreatic cancer

miRNA name Stem-loop primer sequence
mir-21 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAACA
miR-96 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCAAAAATGTG
miR-148a GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGTCGGAG
miR-155 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCCCTATCACG
miR-196a GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCCAACAACATG
miR-217 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCCAATCAGTTC