Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Stem-loop primers for the internal controls

From: Small nucleolar RNA U91 is a new internal control for accurate microRNAs quantification in pancreatic cancer

Control name Stem-loop primer sequence
mir-39 C. elegance GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTATTAC
U6 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAATATGG
U91 snoRNA GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGGCCT
miR-16 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCCAA