Skip to main content

Advertisement

Table 1 List for primer pairs used in qPCR

From: Molecular mechanism of anti-cancer activity of phycocyanin in triple-negative breast cancer cells

Gene Orientation Primer sequence 5′ TO 3′ Accession number
CYCLIN E F TCAGGGTATCAGTGGTGCGA XM_005259370.2
R CAAATCCAAGCTGTCTCTGTG
CDK-2 F TTTGCTGAGATGGTGACTCG NM_001798.4
R CTTCATCCAGGGGAGGTACA
P21 F AAG ACC ATG TGG ACC TGT NM_001291549.1
R GGT AGA AAT CTG TCA TGC TG
BAX F TGCTTCAGGGTTTCATCCAG NM_001291428.1
R GGCGGCAATCATCCTCTG
Bcl-2 F AGGAAGTGAACATTTCGGTGAC NM_000633.2
R GCTCAGTTCCAGGACCAGGC
CASPASE 9 F CCAGAGATTCGCAAACCAGAGG XM_011542273.1
R GAGCACCGACATCACCAAATCC
MCL1 F GGGCAGGATTGTGACTCTCATT NM_001197320.1
R GATGCAGCTTTCTTGGTTTATGG
COX-2 F GATACTCAGGCAGAGATGATCTACCC NM_000963.3
R AGACCAGGCACCAGACCAAAGA
VEGFR2 F TGCCTACCTCACCTGTTTC NM_002253.2
R GGCTCTTTCGCTTACTGTTC
MMP-9 F ACCTCGAACTTTGACAGCGAC NM_004994.2
R GAGGAATGATCTAAGCCCAGC
GAPDH F ACCCAGAAGACTGTGGATGG NM_001289746.1
R CAGTGAGCTTCCCGTTCAG