Skip to main content

Table 1 Primers Sequence used for RT-PCR

From: SDF-1alpha concentration dependent modulation of RhoA and Rac1 modifies breast cancer and stromal cells interaction

Primer FORWARD REVERSE
CXCR4 GCCTTATCCTGCCTGGTATTGTC GCGAAGAAAGCCAGGATGAGGAT
SDF-1 ACTGGGTTTGTGATTGCCTCTGAAG GGAACCTGAACCCCTGCTGTG
GAPDH AGCCACATCGCTCAGACAC GCCCAATACGACCAAATCC