Skip to main content

Table 1 Quantitative real time PCR primer sequences

From: APC selectively mediates response to chemotherapeutic agents in breast cancer

Gene Name Forward Primer (5’ – 3’) Reverse Primer (5’ – 3’)
m18s GGCGGCTTGGTGACTCTAGAT CTTCCTTGGATGTGGTAGCCG
mMDR1 CATTGGTGTGGTGAGTCAGC CTCTCTCTCCAACCAGGGTC
mABCG2 GCCAGTCTATGTTACCTCTTTCTGTCA TGCATTCCAGCGGCATCATATTTCA
hGAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC
hAPC TGTCCCGTTCTTATGGAA TCTTGGAAATGAACCCATAGG
  1. Species is indicated by either an m (mouse) or h (human) before the gene name