Skip to main content

Table 1 RT-PCR primers sequences used for the amplification of multiple human cDNAs

From: The combination of methylsulfonylmethane and tamoxifen inhibits the Jak2/STAT5b pathway and synergistically inhibits tumor growth and metastasis in ER-positive breast cancer xenografts

Sl No Gene Annealing temperature (°C) Product size (bp) Sequence (5’ - 3’)
1 Cyclin-D1 58 135 F – gctgcgaagtggaaaccatc
R – cctccttctgcacacatttgaa
2 IGF-1Rβ 58 522 F – actatgccggtgtctgtgtg
R – tgcaagttctgattgttgag
3 IGF-1 58 498 F – tcctcgcatctcttctacct
R – tctggactcgccagtccaat
4 VEGF 58 405 F – aggagggcagaatcatcacg
R – caaggcccacagggattttc
5 18S 58 490 F – agccttcggctgactggctgg
R – ctgcccatcatcatgacctgg
6 MMP2 53 665 F – gagttggcagtgcaatacct
R – gccatccttctcaaagttgt
7 MMP3 60 432 F – cctgctttgtcctttgatgc
R – tgagtcaatccctggaaagt
8 MMP9 58 455 F – cctgccagtttccattcatc
R – gccattcacgtcgtccttat
9 hIGF-1 (CHIP assay) 60 700 F – tggcatgttttgaggttttg
R – gattggttgtgtggcatgag