Skip to main content

Table 2 Overview of shRNAs and siRNAs used in this study with the aim to silence the expression level of NBPF family members

From: NBPF1, a tumor suppressor candidate in neuroblastoma, exerts growth inhibitory effects by inducing a G1 cell cycle arrest

Knockdown type # Target seq (5' to 3') Targets only NBPF1 Exon type
No Yes
shRNA_19-mer 1 CCUCUUCUGCCACAAACGUUU X   1
2 GGAAUGUGCCAUCACUUGU X   5
3 GGAAGUCCCUGAGGACUCA X   6
4 GAAGAAGAUCAACGAAGAA   X 12
5 CUUACUUUGAUGGGAACAA   X 14
shRNA_29-mer 6 UACCUCUUCUGCCACAAACGUCAGCAUGGU X   1
7 AUGUCAGGAUGCUGUAAACAUUCUCCCAG   X 5
8 AACAUCAACAUCACCUUUGAGGAAGACAA   X 5
9 UGACUCCAACCAGCCUCACAAGAACAUCA X   5
10 GGAGAAGACGGUGUACCAGCCUCACAAGA X   5
11 ACCAGUCUUACAGCGGCACAUUUCACUCA   X 8
12 CCUGACUCAUUCCAGCACUACAGAAGUGU X   14
13 AGCUGGCAGAGAACAAACAGCAGUUCAGA X   1
14 AUGCUGAGGAAUGAGCGACAGUUCAAGGA X   2
15 UAAGGGAGAAGUUACGGGAAGGGAGAGAU X   3
16 CUUCCUGGCCAACCAGCAGAACAAAUACA X   1
siRNA pool 17 GAAUCGUACUGCUAAGAAU   X 5' UTR
ACAGAGACAGACAAAGAUA X   5' UTR
GAUGGCCAAUCUUUCCUAA X   5' UTR
GCAAGUCCAGGUCAUACUG X   5' UTR
  1. Given are the target sequence, the predicted specificity (NBPF1-specific or broad NBPF specificity) and location in exons (for exon type, see ref. [4]) or 5’UTR. shRNAs 1 to 5 represent shRNAs with a stem length of 19 bps, whereas shRNAs 6 to 16 represent shRNAs with a stem length of 29 bps. For shRNAs 1 to 8, the expression cassettes of the shRNAs were created by us by a double PCR-approach, whereas shRNAs 9 to 16 are HuSH retroviral silencing vectors from Origene (Origene Technologies, Rockville, MD, USA). siRNA pool 17 represents an On-Target plus siRNA pool from Dharmacon (Thermo Fisher Scientific, Lafayette, CO, USA)