Skip to main content

Table 1 List of primer sequences used for quantitative RT-PCR of the genes indicated

From: NBPF1, a tumor suppressor candidate in neuroblastoma, exerts growth inhibitory effects by inducing a G1 cell cycle arrest

Gene Forward (5' to 3') Reverse (5' to 3')
ANAP2 GACAGGAGTTGTTAGTGGCCT TCCAGGACCGAGTGTAGCC
ATM ACGTTACATGAGCCAGCAAAT GAAAATGAGGTGGATTAGGAGCA
ATR TCTCAGCCAACCTCCGTGAT GCAGAAGTCTCGTTATGATCCAA
CCND1 GTGCTGCGAAGTGGAAACC ATCCAGGTGGCG ACGATCT
CCNE1 GAGCCAGCCTTGGGACAATAA GCACGTTGAGTTTG GGTAAACC
CDC34 GACGAGGGCGATCTATACAACT GAGTATGGGTAGTCGATGGGG
CDK2 GCTAGCAGACTTTGGACTAGCCAG AGCTCGGTACCACAGGGTCA
CDK4 ATGTTGTCCGGCTGATGGA CACCAGGGTTACCTTGATCTCC
CDK6 GCGCCTATGGGAAGGTGTTC TTGGGGTGCTCGAAGGTCT
CDKN1A CGCTAATGGCGGGCTG CGGTGACAAAGTCGAAGTTCC
CDKN1B CTGCAACCGACGATTCTTCTACT GGGCGTCTGCTCCACAGA
CUL1 ACCAGTCAAACCAAGCACGAG GTCTGCCCCTTTTTCGACTTAG
CUL2 ACGACAATAAAAGCCGTGGTC GGTTCAGGATAGGCCACACATA
CUL3 TGTGGAGAACGTCTACAATTTGG TGCGCCTCTGTCTACGACT
SKP2 ACCTCCAGGAGATTCCAGACC CCCAGGTTTGAGAGCAGTTCC
TP53 CCTCAGCATCTTATCCGAGTGG TGGATGGTGGTACAGTCAGAGC
NBPF1 GCGAGGCTGCCCGAGCTTCT GACTTCGCGTAACTTCCCATTCA
EGFP GAGCTGAAGGGCATCGACTT TCTGCTTGTCGGCCATGAT