Skip to main content

Table 2 Sequence of the primers used for mRNA levels analysis

From: Platelets enhance tissue factor protein and metastasis initiating cell markers, and act as chemoattractants increasing the migration of ovarian cancer cells

Sequence 3′ > 5′ GENE
  N CADHERIN
Forward primer ATTTCCATCCTGCGCGTGAA
Reverse primer TTGTTTGGCCTGGCGTTCTT
  E CADHERIN
Forward primer TTTCTTCGGAGGAGAGCGGT
Reverse primer ATGAGGGTTGGTGCAACGTC
  CD44
Forward primer CCCAGACGAAGACAGTCCC
Reverse primer GCCTCTTGGTTGCTGTCTCA
  TISSUE FACTOR
Forward primer CCAAACCCGTCAATCAAGTC
Reverse primer ACAATCTCGTCGGTGAGGT
  HPRT1
Forward primer GACCAGTCAACAGGGGACAT
Reverse primer ACACTTCGTGGGGTCCTTTTC