Skip to main content

Table 1 Primer sequences

From: The involvement of insulin-like growth factor 2 binding protein 3 (IMP3) in pancreatic cancer cell migration, invasion, and adhesion

  Forward sequence (5′→3′) Reverse sequence (5′→3′) Source
IGF-II AAGTCGATGCTGGTGCTTCT CGGAAACAGCACTCCTCAA [7]
NGFβ ATACAGGCGGAACCACACTC TGCTCCTGTGAGTCCTGTTG [37]
KIF11 CAGCTGAAAAGGAAACAGCC ATGAACAATCCACACCAGCA [38]
KIF14 TTGCTACGATTAGTCCCGCT GCTTTGCAATTTCTGCCTTC [38]
GAPDH TTTAACTCTGGTAAAGTGGATATTGTTG ATTTCCATTGATGACAAGCTTCC [7]