Skip to main content

Table 2 Primers for TP53 exon 2–11 amplification and sequencing analysis

From: Prognostic role of serum p53 antibodies in lung cancer

TP53 exon 2 Fw 5′ GGTTGGAAGTGTCTCATGC 3′
Rv 5′ TTCGCTTCCCACAGGTCTC 3′*
TP53 exon 3 Fw 5′ AGAGACCTGTGGGAAGCGA 3′*
Rv 5′ GCAGTCAGAGGACCAGGT 3′
TP53 exon 4a Fw 5′ TGGTCCTCTGACTGCTCTT 3′
Rv 5′ AAGAAGCCCAGACGGAAACC 3′*
TP53 exon 4b Fw 5′ AGCTCCCAGAATGCCAGAG 3′*
Rv 5′ CAGGCATTGAAGTCTCATGG 3′
TP53 exon 5 Fw 5′GCCCTGACTTTCAACTCTG 3′
Rv 5′ GGCAACCAGCCCTGTCGT 3′*
TP53 exon 6 Fw 5′ CAGGCCTCTGATTCCTCAC 3′
Rv 5′ CTACTGCTCACCTGGAGG 3′*
TP53 exon 7 Fw 5′ CTTGGGCCTGTGTTATCTC 3′
Rv 5′AAATCGGTAAGAGGTGGGC 3′*
TP53 exon 8 Fw 5′ ACAAGGGTGGTTGGGAGTAG 3′*
Rv 5′ CCTCCACCGCTTCTTGTCC 3′
TP53 exon 9 Fw 5′CAAGAAGCGGTGGAGGAGA 3′*
Rv 5′ TCCACTTGATAAGAGGTCCCA 3′
TP53 exon 10 Fw 5′ CCATCTTTTAACTCAGGTACTG 3′
Rv 5′TGAAGGCAGGATGAGAATGG 3′*
TP53 exon 11 Fw 5′CACAGACCCTCTCACTCAT 3′
Rv 5′TCCTGGGTGCTTCTGACG 3′*
  1. *Primers used for sequencing; Fw, forward; Rv, reverse.