Skip to main content

Table 1 Primer sequences for semi-quantitative RT-PCR and qRT-PCR

From: The tumour-promoting receptor tyrosine kinase, EphB4, regulates expression of Integrin-β8 in prostate cancer cells

Gene Forward primer 5’ to 3’ Reverse primer 5’ to 3’ Product size (bp)
ITGA3 AGCGCTACCTGCTCCTGGCT GGGCAGTGAGTGGGCACAGG 99
ITGA10 CTGACAGGTCTCTGCTCCCCC CCATCGCTGTCCACCCCCAA 120
ITGB8 TGTGTGCTGGGCATGGAGAGTGT CAGTGCTGGGCTGCTGCTGAA 100
ITGAV CATCTGTGAGGTCGAAACAGG TGGAGCATACTCAACAGTCTTTG 137
EPHB4 TCAATGTCACCACTGACCGAGAGGTA GGTATTTGACCTCGTAGTCCAGCACA 141
GAPDH CTGCACCACCAACTGCTTAG GTCTTCTGGGTGGCAGTGAT 108