Skip to main content

Table 2 Primer, amplicon size and annealing temperature of each gene for qRT-PCR

From: STK33 overexpression in hypopharyngeal squamous cell carcinoma: possible role in tumorigenesis

Gene Forward 5′to3′ Reverse 5′to3′ Product length/bp Tm/°C Genbank NCBI reference sequence
STK33 CCCCGACTGTTCATCTGCTTCT TGCCCACTTCGTTTCTGTTTCC 391 54 Nm_030906.2
ERK1/2 TCCAAGGGCTACACCAAGTC CTCGTCACTCGGGTCGTAAT 363 60 Nm_002745.4
Caspase-3 CAGAACTGGACTGTGGCATTG GCTTGTCGGCATACTGTTTCA 192 54 Nm_004346.3
Bcl-2 GTGGCCTTCTTTGAGTTCGG TCCACAGGGCGATGTTGTC 88 55 Nm_000633.2
Ki-67 TGTCACATCGCTATTTCAAATTCAG GGAGGGCTTGCAGAGCATTTATC 170 54 Nm_001145966.1
E-Cadherin GGGGTCTGTCATGGAAGGTGCT GTAAGCGATGGCGGCATTGTAG 103 57 Nm_004360.3
Vimentin AGGCAGAAGAATGGTACAAATCC TTTAAGGGCATCCACTTCACAG 146 55 Nm_003380.3
Nm-23-H1 CTGGGACCATCCGTGGAGACT TCCTCAGGGTGAAACCACAAGC 112 55 Nm_000269.2
GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA 130 55 Nm_001289746.1