Skip to main content

Table 1 List of primers used in the RNA analysis

From: Liposome encapsulated zoledronate favours M1-like behaviour in murine macrophages cultured with soluble factors from breast cancer cells

Transcript Primers (5′ → 3′)
iNOS F ACCGCACCCGAGATGGTCAGG
R TGCCGGCACCCAAACACCAA
IL-6 F AGAGACTTCCATCCAGTTGCC
R TCTCATTTCCACGATTTCCC
IL-12 F CCCCTGGAGAAACAGTGAACCT
R CACGTGAACCGTCCGGAGTA
MMP-9 F CGGCACGCCTTGGTGTAGCA
R TCGCGTCCACTCGGGTAGGG
GAPDH F GCCGCCTGGAGAAACCTGCC
R GGGGTGGGTGGTCCAGGGTT