Skip to main content

Table 2 Primers and probes for TaqMan qRT-PCR

From: Inverse correlation between PDGFC expression and lymphocyte infiltration in human papillary thyroid carcinomas

Gene Sequence (5'-> 3') Amplicon (bp) Genebank Acc.No
PDGFA   
   (+) TCGATGAGATGGAGGGTCG 71 NM_033023
   (-) ACCCGGACAGAAATCCAGTCT   
   FAM-TGAGACCTCTGCACTTCCATCCCACG-TAMRA   
PDGFB   
   Applied Biosystems Assay On Demand, Hs00234042_m1 80 NM_033016.1
PDGFC   
   (+) TATCTGATGAATATTTTCCTTCTGAACCAG 96 NM_016205
   (-) GTAGCACTGAAGGACTCACAGCTTCT   
   FAM-TTCTGCATCCACTACAACATTGTCATGCCACAATTC-TAMRA   
PDGFD   
   Applied Biosystems Assay On Demand, Hs00228671_m1 73 NM_033135.3
PDGFRA   
   (+) CAAGAGGAACAGACACAGCTCGCAGA 84 NM_006206
   (-) CTGCTGGAACCCGTCTCAAT   
   FAM - CAAGAGGAACAGACACAGCTCGCAGA-TAMRA   
PDGFRB   
   Applied Biosystems Assay On Demand, Hs00182163_m1 86 NM_002609.3
LTB2   
   Applied Biosystems Assay On Demand, Hs00242739_m1 78 NM_002341.1
IL2RG   
   Applied Biosystems Assay On Demand, Hs00173950_m1 76 NM_000206.1
FYB   
   Applied Biosystems Assay On Demand, Hs01061565_m1 123 NM_001465.3
IL32   
   Applied Biosystems Assay On Demand, Hs00992441_m1 85 NM_004221.4
  1. Individual assays were either designed (PDGFA, PDGFC and PDGFRA) or ordered from Applied Biosystems, Assay On Demand, (PDGFB, PDGFD, PDGFRB, LTB2, IL2RG, FYB and IL32).