Skip to main content

Table 2 Primer pairs for amplification of marker gene sequences for RT-PCR expression and immunobead RT-PCR analyses.

From: Long term survival following the detection of circulating tumour cells in head and neck squamous cell carcinoma

Primer Name Primer Sequence
5'-3'
Annealing Temperature Product Size
ELF3 F CTCGGAGCTCCCACTCCTCAGA 68°C 188 bp
ELF3 R GCTCTTCTTGCCCTCGAGACAGT   
EphB4 F CCCCAGGGAAGAAGGAGAGCTG 68°C 251 bp
EphB4 R GCCCACGAGCTGGATGACTGTG   
EGFR F TGTGAGGTGGTCCTTGGGAATTTGG 66°C 339 bp
EGFR R TGCTGACTATGTCCCGCCACTGGA   
CEA F GGTTGGGGTTGCTCTGATATAGCAGC 68°C 97 bp
CEA R GCTGTTGCAAATGCTTTAAGGAAGAAGC   
CK19 F GACTACAGCCACTACTACACGACC 68°C 743 bp
CK19 R AGCCGCGACTTGATGTCCATGAGCC   
EpCam F GGACCTGACAGTAAATGGGGAAC 68°C 186 bp
EpCam R CTCTTCTTTCTGGAAATAACCAGCAC   
  1. The sequences of forward (F) and reverse (R) primers for each of the markers are shown in 5' to 3' direction and were used at the indicated annealing temperature to generate a PCR product of the size indicated in base pairs (bp).