Skip to main content

Table 2 Primers for amplification of the fragments containing SNP markers.

From: Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

SNP Forward primer sequence (5' → 3') Reverse primer sequence (5' → 3') bpa
Gene MLH1
c.1- 93G>A CAACCCACAGAGTTGAGAAATTT GCTCAACGGAAGTGCCTT 152
c.453+79A>G TGGAAAACTGAAAGCCCC TTAGAGGATATCTTGGGACCTCC 201
c.655A>G CGTGGACAATATTCGCTCC CTAAAGCAAACTCTTAACACACATAATATC 156
c.790+955C>A CCAGCTGTAAATGTTTCAAAATAT AACATTTTCTGAGCCTTGATTAAA 200
c.791- 1406C>T CAGAGTACAGTGACATTAATGAT TCTCTCTGAACAGATTTAGATGA 183
c.791- 488A>G TGATACCATTTCTGTGCCATTTT GGCCAGCACTATTATAGACGT 157
c.1038+86T>C GTCAGGGCGCTTCTCATC GGAACAACAGCACAATACCTT 173
c.1039- 78A>G ATAATTTTAAGATTATAAGGATTTTG GTGGAGAGACTCAGAATAAGA 186
c.1668- 19A>G ACAGCCAGGCAGAACTATTTC TGAGTATCTGGTAGAACAGTTCTTC 153
c.1990- 121C>T CCTGCTCTCATCCCCACT ACCTGGTCCAAAGAAATTCA 178
Gene MSH2
c.1076+1681G>T AACGATATTGGAATGATTGGATC ACTTGCAAATTACCCAGTCCTT 177
c.1077- 80G>A AAATGGAATTTTGAGCTGATTT ATCTTCTACAAAAGCTTCCACTAA 134
c.1276+1349T>A GTTGTTATGTCTAATACATAAAGC TCAAAACGTATGTTTTAATGGTTC 157
c.1276+1394A>T GTTGTTATGTCTAATACATAAAGC TCAAAACGTATGTTTTAATGGTTC 157
c.1277- 212T>A CATGTTTCTGCATCTATATTACTT TAAACAAGCATCATTTGATCCAAA 201
c.1277- 118G>A CATGTTTCTGCATCTATATTACTT TAAACAAGCATCATTTGATCCAAA 201
c.1386+719T>C TCAGTCTTAGCCTCCCAAAAT CGACAACTATTTAGGAGATGCA 131
c.1387- 914A>G AGTCTCAGTATGTCACCTAGG TAGCAGTGCGCACCTGTAGT 131
c.1511- 91G>T CAAGTAAGTAGTATTTGAATCTTTTCTG GCACTGGAATCCAGTTTAATCT 202
c.1511- 9A>T CAAGTAAGTAGTATTTGAATCTTTTCTG GCACTGGAATCCAGTTTAATCT 202
c.1661+12G>A TCCAGAAGAATGGTGTTAAATTT TTAGTAAAACTTATCATAGAACATTCAC 120
c.1759+107A>G GGCTTTTGGTAACAGAAGAAAAA CTGCCATTTTTTGTTTCTATGTG 176
c.1759+183G>A GGCTTTTGGTAACAGAAGAAAAA CTGCCATTTTTTGTTTCTATGTG 176
c.1760- 1207C>T TAATTAGGTCTGCTTGGCCATT CAGAACATTCAAGATAAAAGCATT 166
c.2006- 6T>C ACATCTTTGGGCAGGCTG CCATGAGTACTATCACCCCA 214
c.2210+175G>A GTCTTAGTTTAATAGTTGTTTTCC ATTCCAGGAAGTGTGAACAGT 198
c.2210+274T>G GTCTTAGTTTAATAGTTGTTTTCC ATTCCAGGAAGTGTGAACAGT 198
c.2635- 214T>C CCAGTATTCTTTGTAAACCTTGA GTCTCAAACTCCTCCCACATT 156
  1. a size of amplicon in base pairs (bp); Note: several SNPs are located on the same amplicon