Skip to main content

Table 1 Primer used for genotyping

From: TRPV6 alleles do not influence prostate cancer progression

Sequence (5'-3'):
243 caccatgtgctgcatctacc
244 caatgacagtcaccagctcc
430 atggactctgagctctatgagg
431 cccacatctcagctcagg
778 cacggtgaatgctggagcg
779 ccaggaagcgaagtgagaac
780 cgtctgaagcgcacgtcc
781 cttgaagtccgccagcagg
637 gctcgagatgtcatgaagg
638 agttgagagatcatctccacc