Skip to main content

Table 1 Oligonucleotides used for RT-PCR and ChIP

From: NK-like homeodomain proteins activate NOTCH3-signaling in leukemic T-cells

Gene Acc.No Forward primer
(5'-3')
Reverse primer
(5'-3')
PCR product (bp)
HEX NM_002729 GCAAACCTCTACTCTGGAGC TTCACTGGGCAAATCTTGCC 311
HMX1 NM_018942 AGGCGGCCTCAGTCCTGACA TGCGGGAGAAGACTGTGCGC 263
HMX2 XM_370580 GCTTCACCATCCAGTCCATC TTAAAGTCCGAGTGCGAAGG 295
HMX3 XM_291716 TGGCTTTCCCTCGCTTTGAG TCCTCCAGAATGATCTCGTC 265
MSX1 NM_002448 AGAAGATGCGCTCGTCAAAG ATCTTCAGCTTCTCCAGCTC 339
MSX2 XM_037646 AGATGGAGCGGCGTGGATGC ACTCTGCACGCTCTGCAATGG 194
   GAATTCGAAGTCATGGCTTCTCCGTCC TTGAATTCGGTGGTACATGCCATATCCC 811
NKX1-1 XM_926341 AATCTGACAGGAGCGATTGG TGGAACCAGATCTTCACCTG 392
NKX1-2 XM_372331 TGGACCCACAGAAATTCACC AACTTGTTCTCCAAGGCCAC 460
NOTCH3 NM_000435 CCGCACCCAGCCTATTATTG AGAAGTGGGAGGATCGCTTG 219
   TAGACTGTCAGCTCCCTGAG GCCCAGGAGTCTGAGGCTGC 156
TEL NM_001987 AGGCCAATTGACAGCAACAC TGCACATTATCCACGGATGG 272