Skip to main content

Advertisement

Table 2 Characteristics of the gene-specific qPCR assays

From: Clinical relevance of nine transcriptional molecular markers for the diagnosis of head and neck squamous cell carcinoma in tissue and saliva rinse

Gene name (synonym) Access n° Gene ID Gene location Primer sequence 5'-3' Amplicon size Melting T°c PCR efficiency
KRT4 NM_002272 12q12-q13 f: tcaacaacaagtttgcctc 185 1.94
keratin 4 3851   r: gtcattgcccaaggtatcta 90  
IL1RN NM_173841 2q14.2 f: cctgtcctgtgtcaagtctg 257 1.80
interleukin 1 receptor antagonist 3557   r: cgtcctcctggaagtagaat 90  
KRT13 NM_153490 17q12-q21.2 f: tctctgtcttgctggtctga 234 1.88
keratin 13 3860   r: atgaagaggagatgaaggaa 89  
MMP1 NM_002421 11q22.3 f: aaagacagattctacatgcg 237 1.92
matrix metallopeptidase 1 4312   r: tgcttcacagttctaggga 85  
PLAU NM_002658 10q24 f: ggactacatcgtctacctgg 230 1.90
plasminogen activator, urokinase 5328   r: caaactggggatcgttatac 88  
SPARC NM_003118 5q31.3-q32 f: ggtgactgaggtatctgtgg 245 1.85
secreted protein acidic cysteie-rich 6678   r: aggtcttgttgtcattgctg 90  
TGM3 NM_003245 20q11.2 f: cactctccaatggcagtagt 215 1.93
transglutaminase 3 7053   r: cataaagacgctatccacat 88  
FN1 NM_212482 2q34 f: tgacacttatgagcgtcct 234 1.81
fibronectin 1 2335   r: aaacacttctcagctatggg 86  
MAL NM_002371 2cen-q13 f: ataaagccgcagtagaactt 181 1.95
mal, T-cell differentiation protein 4118   r: agagtaaacacagcacccac 84  
ACTB NM_001101 7p15-p12 f: tggctggggtgttgaaggtct 238 1,89
actin, beta 60   r: agcacggcatcgtcaccaact 90  
B2M NM_004048 15q21-q22.2 f: cagcgtactccaaagattca 240 1.99
beta-2-microglobulin 567   r: gaatgctccactttttcaat 90  
RPS18 NM_022551 6p21.3 f: agcttgttgtccagaccatt 187 1.84
ribosomal protein S18 6222   r: tgaggaaagcagacattgac 87  
  1. T°c: Temperature