Skip to main content

Table 1 Details of primers and probes used for quantitative PCR

From: Expression of oestrogen receptors, ERα, ERβ, and ERβ variants, in endometrial cancers and evidence that prostaglandin F may play a role in regulating expression of ERα

cDNA Forward Primer Reverse Primer Roche Probe
ERα ttactgaccaacctggcaga atcatggagggtcaaatcca 24
ERβ1 gctcctgtcccacgtcag tgggcattcagcatctcc 62
ERβ2 tgggtgattgccaagagc gtttgagaggccttttctgc 52
ERβ5 gctcctgtcccacgtcag cacataatcccatcccaagc 17
PR tttaagagggcaatggaagg cggattttatcaacgatgcag 11