Skip to main content

Table 1 primers sequences

From: Heparanase activity in alveolar and embryonal rhabdomyosarcoma: implications for tumor invasion

Gene Sequences 5'→ 3'
HPSE d – ATTTGAATGGACGGACTGC
  r – GTTTCTCCTAACCAGACCTTC
MMP2 d – GCGGCGGTCACAGCTACTT
  r – CACGCTCTTCAGACTTTGGTTCT
MMP9 d – CCTGGAGACCTGAGAACCAATC
  r – CCACCCGAGTGTAACCATAGC
MMP14 d – TGCCATGCAGAAGTTTTACGG
  r – TCCTTCGAACATTGGCCTTG
GAPDH d – ACACCCACTCCTCCACCTTT
  r – TCCACCACCCTGTTGCTGTA