Skip to main content

Table 1 Primers used to clone microRNA precursors in this study

From: Systematic validation of predicted microRNAs for cyclin D1

MicroRNA 5' primer 3' primer
miR-19a GCATCTACTGCAGTGAAGGC GCGGCCGCAGTTTGATTGGGCGACAGG
miR-491 AGATGGCTTTCTGGGTAGCC GCGGCCGCTAACAGTAACACGTATGGGC
miR-296 CCTCCTTGGAGCTGAGATGG GCGGCCGCGTGGGAGGTAGGTAAAACTC
miR-532 CATCTGTTCTCGTATGTGTG GCGGCCGCACGTAAGAGAGGGTTTACC
miR-188 CTTCCCTCTCCAGTGCATAG GCGGCCGCTCCTGCAGGATCCATGTAAG
miR-579 CAGTGACAGAGTTGTGTAAC GCGGCCGCGTGGAAACAAGTTGCATGTC
miR-501 AGACCCTCAAGTGTGATCTG GCGGCCGCAGTATATGCAGGGGCAATG
miR-548c TCAGGGTTTCACCATGTTGG GCGGCCGCACAGAGCAAGACTCCATCTC
miR-219-1 CGTTTACTCTAGAGTCCTCG GCGGCCGCACAGAGGGCTCGTGAAAAGG
miR-340 TGGCTACCTGTTCAGCTTTC GCGGCCGCAGCAGTTTACCAGAATACCG
miR-519b CTGGACACAAAACTCAGGAG GCGGCCGCGTCTGGGTCACAGAGCAAG
miR-155 TGCCTAAAGGTAACAATGTC GCGGCCGCGGTTGAACATCCCAGTGAC
miR-519e GGTATGTGTGGTAGGCTTTG GCGGCCGCAACTAGCCTAAGAGGTCTAG
miR-515-1 TACATGCCACCACAGGCGGC GCGGCCGCCTGGGCCACAGAGAGAGAC
miR-139 GATCGTGCAGGCAACTCTTG GCGGCCGCTGGATAACAAGGCAGTATGG
miR-494 TTCCCGGGCAACCTCTTTTC GCGGCCGCTCCTTCAACCACAGAAGCAC
miR-203 CGTCTAAGGCGTCCGGTACG GCGGCCGCTTCCCACAGCACAGCCCGGC
miR-142 GATGGGGTGGAGCCTTTAGG GCGGCCGCAACCAGGAAGGGCAGGAAAG
miR-450-1 TGATTATCTCTGAGTTGTGG GCGGCCGCAAAATGATCCCAATACAC
miR-193a AGTTTCTCGGCGCATAACTC GCGGCCGCTATTTCTCCAGCGAAGTG
miR-193b GTTGTCCGGGAAGCTTTTAG GCGGCCGCCCTCGAAGGGACCTTTTAG
miR-487b TGGTCTGGGTCCCTGCTTCC GCGGCCGCAGTCATAAAACCACCACCAC
miR-487a CAGTCTCATGAGGGAGTGCC GCGGCCGCTCTCACTGGTCAACTTCCC
miR-301 AGGGCTTGTTTTACATGGCG GCGGCCGCCAGACGTGTTTCATAATGC
miR-130a CTGCTTTAGTGGGTCCTGTC GCGGCCGCTAACGGAGGCAGTGTCTATC
miR-130b GTCAAAGCATCTGGGACCAG GCGGCCGCACCTGATCCTCTGATGGAG
miR-148a CTTTGCTGTGACATTGCGAC GCGGCCGCTTTGGGGGGATTTTGTTCCC
miR-503 CTCGTGGGGAAGGTAGAAGG GCGGCCGCAAGATAGGTTTTCTTCGTTG
miR-152 AGCAGCCAACTCAGAACTCG GCGGCCGCAAGGTCCACAGCTGGTTCTG
miR-95 CCTCCTGAGGAATCCAGGCG GCGGCCGCGATCGGGCCCTTGCGAAGCC
miR-550 GAGCCTTCTAACCACAACCC GCGGCCGCATAAAGCAGTTCCTACACTC
miR-545 TCATGCCAGTGTCTAGTTCC GCGGCCGCCACCAAGAAAGCAAGTGTC
miR-424 ACCCACTACGTTGTTCCAAG GCGGCCGCAGAGCACCGATCGCTCACTG
miR-15a AAAGGTGTACTGCAAGGAAC GCGGCCGCACTGCTGACATTGCTATC
miR-16 GCTAGGTTGGATGAATCCTAC GCGGCCGCCATCCAAAGTGTTACAAAG
miR-497 CCTGAGCTGAGTTCCTACAG GCGGCCGCGTGTGGGCAACAAAGACTCC
miR-195 GTGACACAAAAAACATCTGG GCGGCCGCATAAGCATCTGCCCCCAACC
miR-515-2 CGAGTAGCTGGGACTACAGG GCGGCCGCATACCAGCTACTCGGGAGGC
miR-144 ATTACGCCATCTCTGGCTTG GCGGCCGCACGTTTTCTGGGTATAGC
miR-34a ATGGAGTCTTGCTAGTTGCC GCGGCCGCTACGTGCAAACTTCTCCCAG
miR-449a TTGAAGTAATACATTTTGTG GCGGCCGCACTGTCTACTCCGAAAGAC
miR-146a GTAGAGACAAATTCTCCATG GCGGCCGCTTTCTCACAGGAACTCACAC
miR-655 AATCCGTGGAGGAAGCTTTC GCGGCCGCACAGCAAACACAGCAAAGC
miR-374 GTTCCTTTATTGGAAGTCTG GCGGCCGCAGGCACACAATAAATGTTTG
miR-524 AGTAGAGACAGGGTTTCACC GCGGCCGCGATAGAGAGACTCTGTCCGC
miR-520d CTGGTGTCTAACTCCTGAGA GCGGCCGCTGACCATTTGAAGCCAAGAG
miR-376a-1 CCTGAGTAGGTGCAAAGATG GCGGCCGCATTATGTGTGCACCAAGGGC
miR-23b AATTGTGTGTGTCGCATGGC GCGGCCGCGGTGCAGAACTTAGCCACTG
miR-23a GCCATGCAAGTTGCTGTAGC GCGGCCGCTTCCTGCTGAACTGAGCCAG
miR-199a-2 AGCGCATACCCAAACCTCCC GCGGCCGCGTCAAGAAGGCCTTACCCGC
miR-199b GGGGTTGGACACTAGGTAGG GCGGCCGCAGGTTTTGGGGTGAGGGAGG
miR-194-1 CTAATGGCATTATCTCACAG GCGGCCGCGATGACTTTAATCCTCTTCC
miR-202 CCTGCGCATAAATGTGGAGC GCGGCCGCTCCTCTCTGCATCCTGGGTC
miR-875 TATACCTCAGTTTTATCAGGTG GCGGCCGCGTGCATAGCTTCTGTAAAGG
miR-511-1 AATGGCCTCTAGTTGCATCC GCGGCCGCATAGATCACTTACCTGAGGG