Skip to main content

Table 1 Primer sequences for HPV typification

From: Low NKp30, NKp46 and NKG2D expression and reduced cytotoxic activity on NK cells in cervical cancer and precursor lesions

VIRUS Primer Sequences (5'-3') Amplimer length
(base pair)
HVP
(CpI/CpII)
(DNA) – CGTCCAAGAGGATACTGATC 1F
(DNA) – GCACAGGGTCATAATAATGG 1R
188
HVP6/11 (DNA) – CTCTGCCGGTGGTCAGTGCAT 1F
(DNA) – ATGCCTCCACGTCTGCAAC 1R
120
HVP16 (DNA) – CTGCACATGGGTGTGTGC 1F
(DNA) – GCAGCTCTGTGCATAAC 1R
229
HVP18 (DNA) – GAATTCACTCTATGTGCAG 1F
(DNA) – TAGTTGTTGCCTGTAGGTG 1R
221
HVP31 (DNA) – TTCAAAAATCCTGCAGAAAG 1F
(DNA) – CTTTGACACGTTATACACCT 1R
320
HVP33 (DNA) – ACCTTTGCAACGATCTGAGG 1F
(DNA) – GAACCGCAAACACAGTTTAC 1R
108
  1. * w = a or t; s = c or g; y = c or t