Skip to main content

Table 1 Oligonucleotides used for NBN PCR amplification and sequencing.

From: Variations in the NBN/NBS1 gene and the risk of breast cancer in non-BRCA1/2French Canadian families with high risk of breast cancer

  F/R1 Oligonucleotide sequence (5'→3') Annealing temp. (°C) PCR lenght (bp) MgCl2 final conc. (mM) Comments
Genomic sequence
Exon 1 F GACGTTAAGACAAGTTGATTTGAACTTAGA* 60 965/ 0.5 2% DMSO added to the PCR reaction
  R TCCGCCCATGCTAACTTCCT   1113   
  F2 TTTAGTAGTGCGCAGGATGTAGAC     
Exon 2 F CCTTTGATAGCCTTCAGTGAGGC 64 743 1.0 Sequencing primer:
  R AGCCAGAGTCATGAAGGTCTGTTC     CCACTGGTACCACTGCCACA
Exon 3 F GTCAGGAGAATCCCCACTGACTT* 60 548 1.5  
  R GGCACAGAGTCCAATACTGTGCT     
Exon 4 F TGGGAAGTTACATTTCTTCGATTCC* 58 728 1.5  
  R GCACTGTCATAACCTTCTCGGTG     
Exon 5 F GCAGTGACCAAAGACCGACTTCTA* 58 561 1.5  
  R TGAGGTTACCTCAGTGCCATTTACT*     
Exon 6 F AAACGCGATTAGATGCTTTTTGTC* 60 630 1.5  
  R ACCCCACTTTGGTACACAGAAC     
Exon 7 F CCACAGAGAGTGTAACAGTTCCAGG* 63 1100 1.0 2% DMSO added to the PCR reaction
  R TTAATTCTTGTATCGGCCGGG     
Exon 8 F TAACAGTGCCCCAGCGAGTAAG* 58 785 1.5  
  R TCCTCTTACACTGTCGACCCTTAGA     
Exon 9 F TTAGATAAGCCCGTCATAGATGCC* 58 516 1.5  
  R TAACTACTCGCCGCTCCTTTACA     
Exon 10 F GTTTGTCAGTCGTCTATAGTGGAGCA* 58 763 1.5  
  R AATTGCGGCAAGTAAAATAACACG     
Exon 11 F CCCTGCCCACAACCTTACTACG* 60 1500 1.5  
  R GACCACAGCCATGAATGAGTGG *     
Exon 12 F TCCTACCATCTACAGACAACCATGG 58 619 1.5  
  R CCATGATCAATCCATTTCAAGGC *     
Exon 13 F GCAAACAGTGCTGAGATTTTGTGTC 58 850 1.5  
  R CCTGAGCTAAAGAACCTCCTCAAGTAG *     
Exon 14 F CAACATCTCCTGCTTGGACTCTG 60 638 1.0 Sequencing primer:
  R GAAGAATTTGCTTGAAGGCCACC     GATGGGTTTAGAACAGAGTTACTGCT
Exon 15 F GAACTCAGATGTGGTGACCTCCAG 58 441 1.5  
  R CAATTTCACACAATTCGGGAACC *     
Exon 16 F GAGGAATGGGGATCTTTGAAGC 58 457 1.5 Sequencing primer:
  R GTAACTTAAATCGCTTCTATACAC     AAGCAACATCAAAGGGATACATGA
cDNA
PCR 1 F GTTACGCGGTTGCACGTCG 64 998 1.5 Exons 1 to 8
  R GTCATGAAAATCACCGCCAATC     
PCR 2 F TCTTTTTGGCTCCGGGAACG 62 567 1.5 Exons 7 to 10
  R GCTGCTGCTGAGAAGCCCTATC     Overlap of 169 pb with PCR1
PCR 3 F CCCACTGTAAAGGAGTCCTGCA 62 634 1.5 Exons 10 to 12
  R TACTTTCTGGTACTGCTTCATCACT     Overlap of 151 pb with PCR2
PCR 4 F CCATAGAAGATGAAGTATTGGA 62 700 1.5 Exons 11 to 16
  R GTAACTTAAATCGCTTCTATACAC     Overlap of 165 pb with PCR3
Promoter cloning
  F GACGACGCTAGCGACGTTAAGACAAGTTGATTTGAACTTAGA 62 515 1.0 2% DMSO added to the PCR reaction
Added restriction sites are underlined
  R GACGACAAGCTTATCGGTCCGGCTCCTCAGGGCTG     
  1. 1 Primer direction: forward (F) or reverse (R) 2 Alternative primer Oligonucleotides used as sequencing primers are marked with an (*)