Skip to main content

Table 1 Primer sequences, amplification sizes and annealing temperatures used in RT-PCR.

From: Cytoplasmic Kaiso is associated with poor prognosis in non-small cell lung cancer

Primer sequence(5' -> 3') Amplification range PCR setting Annealing Number of cycles
Kaiso TGCCTATTATAACAGAGTCTTT 719–966 (NM_006777.3) 50°C, 40 sec 30 cycles
  AGTAGGTGTGATATTTGTTAAAG   
Matrilysin TCTTTGGCCTACCTATAACTGG 241–660
(NM_002423.3)
53°C, 40 sec 35 cycles
  CTAGACTGCTACCATCCGTC   
β-Actin AGAGCTACGAGCTGCCTGAC 797–1096
(NM_001101.3)
55°C, 40 sec 30 cycles
  AGTACTTGCGCTCAGGAGGA