Skip to main content

Table 1 Characteristics of primers used for conventional RT-PCR

From: Down-regulation of GRP78 is associated with the sensitivity of chemotherapy to VP-16 in small cell lung cancer NCI-H446 cells

Genes Sequence of primers Products(bp)
GRP78 5' GATAATCAACCAACTGTTAC 3'
5' GTATCCTCTTCACCAGTTGG 3'
577
β – actin for GRP78 5' TCGTCACCAACTGGGACGACATGG 3'
5' GATCTTGATCTTCATTGTGCTGGG 3'
750