Skip to main content

Table 3 Sequence of the mutation-specific TaqMan probes and PCR primers for the EGFR gene

From: Frequently increased epidermal growth factor receptor (EGFR) copy numbers and decreased BRCA1 mRNA expression in Japanese triple-negative breast cancers

Mutation No. Probe name Nucleotide Amino Acid Primer sequence (forward)
  WT1    CCCAGAAGGTGAGAAAGTTAAAATTC
1 Del 1a 2235-2249del E746-A750del (same as above)
2 Del 1b 2236-2250del   (same as above)
3 Del 2 2254-2277del S752-I759del (same as above)
  WT2    (same as above)
4 Del 3 2239-2247del, 2248G>C L747-E749del, A750P (same as above)
5 Del 4 2240-2257del L747-S752del, P753S (same as above)
6 Del 5 2238-2255del, 2237A>T L747-A750del, E746V (same as above)
7 Del 6 2240-2251del L747-A750del, T747S (same as above)
  WT3    TGAGGATCTTGAAGGAAACTGAATTC
8 G719C 2155G>T G719C (same as above)
9 G719S 2155G>A G719S (same as above)
  WT4    CCGCAGCATGTCAAGATCAC
10 L858R 2573T>G L858R (same as above)
  WT5    (same as above)
11 L861Q 2582T>A L861Q (same as above)
  WT6    CCCAGAAGGTGAGAAAGTTAAAATTC
12 L747Del 2239-2262del L747-K754del (same as above)
13 N756Ins 2265-2267InsCAA N756Ins (same as above)
  WT7    GGAGGACCGTCGCTTGGT
14 L838P 2513T>C L838P (same as above)
TaqMan probe Primer sequence (reverse)    
VIC-ATTAAGAGAAGCAACATCT CCCACACAGCAAAGCAGAAA    
FAM-CGCTATCAAAACATCT (same as above)    
FAM-CTATCAAGACATCTCC (same as above)    
FAM-AGAAGCAACACTCGAT (same as above)    
VIC-CGAAAGCCAACAAG (same as above)    
FAM-CAAGGAACCAACATC (same as above)    
FAM-AAGGAATCGAAAGCC (same as above)    
FAM-CAAGGTTCCGAAAGC (same as above)    
FAM-TCAAGGAATCATCTCC (same as above)    
VIC-AAGTGCTGGGCTCC TGCCAGGGACCTTACCTTATACA    
FAM-AAAGTGCTGTGCTCC (same as above)    
FAM-AAAGTGCTGTGCTCC (same as above)    
VIC-TTGGGCTGGCCAAA TCCTTCTGCATGGTATTCTTTCTCT    
FAM-TTGGGCGGGCCAA (same as above)    
VIC-CCAAACTGCTGGGTG (same as above)    
FAM-CCAAACAGCTGGGTG (same as above)    
VIC-ATTAAGAGAAGCAACATCT CCCACACAGCAAAGCAGAAA    
FAM-CTATCAAGGAAGCCAACAA-MGB (same as above)    
FAM-CCAACAACAAGGAAAT-MGB (same as above)    
VIC-CGCGACCTGGCAG-MGB CCCAAAATCTGTGATCTTGACATG    
FAM-CGCGACCCGGCAG-MGB (same as above)