Skip to main content

Table 2 HER2-neu primers

From: Genomic activation of the EGFR and HER2-neu genes in a significant proportion of invasive epithelial ovarian cancers

  First step(5'—3') Second step(5'—3') Product Size(BP)
Exon18 F: ccagcactgacccaccac F: ccagcactgacccaccac 228
  R: ctcttgcccctcccatca R: *agaactgccgaccacacc  
Exon19 F: cccacgctcttctcactcat F: cccacgctcttctcactcat 183
  R: agagaccagagcccagacct R: *gggtccttcctgtcctccta  
Exon20 F: tgtggtctcccataccctct F: *ctctcagcgtacccttgtcc 230
  R: caaagagcccaggtgcatac R: caaagagcccaggtgcatac  
Exon21 F: tacatgggtgcttcccattc F: tacatgggtgcttcccattc 201
  R:catgggctagacaccactcc R: *gctccttggtccttcaccta  
Exon22 F: tagcccatgggagaactctg F: *ctccccacaacacacagttg 186
  R: agctctcatcctccctccag R: agctctcatcctccctccag  
Exon23 F: actcctgaccctgtctctgc F: actcctgaccctgtctctgc 220
  R: ctttcatgccccttgtgg R: *aggacctcccaccctcct  
Exon24 F: accagactggagggggagt F: *agaggcagcaagcacacag 203
  R: gagggtgctcttagccacag R: gagggtgctcttagccacag  
  1. HER2-neu primers used for amplification (hemi-nested PCRs)
  2. * indicates that a GC clamp was added at the 5' end of the primer,
  3. GC clamp: cgcccgccgcgccccgcgcccggcccgccgcccccgcccg