Skip to main content

Table 1 EGFR primers

From: Genomic activation of the EGFR and HER2-neu genes in a significant proportion of invasive epithelial ovarian cancers

  First step (5'—3') Second step (5'—3') Product Size(BP)
Exon18 F: agcatggtgagggctgag F: *gctgaggtgacccttgtctc 258
  R: acagcttgcaaggactctgg R: acagcttgcaaggactctgg  
Exon19 F: catgtggcaccatctcaca F: catgtggcaccatctcaca 179
  R: ccacacagcaaagcagaaac R: *ggtgtgtcgtttcgtctttg  
Exon20 F: cgaagccacactgacgtg F: cgaagccacactgacgtg 244
  R: ctatcccaggagcgcagac R: *ccgtatctcccttccctgat  
Exon21 F: cctcacagcagggtcttctc F: cctcacagcagggtcttctc 215
  R: aatgctggctgacctaaagc R: *ccgactggatttcg  
Exon22 F: tttttccaacagagggaaact F: *cactgcctcatctctcacca 237
  R:aaagaaaatacttgcatgtcagagg R:aaagaaaatacttgcatgtcagagg  
Exon23 F: ccactgccttcttttcttgc F: *tttcttgcttcatcctctcag 205
  R: cagctaggcagtgtggacag R: cagctaggcagtgtggacag  
Exon24 F: gcatcaccaatgccttcttt F: *gcaatgccatctttatcatttc 200
  R: actcttcccaatggaagcac R: actcttcccaatggaagcac  
  1. EGFR primers used for amplification (hemi-nested PCRs).
  2. * indicates that a GC clamp was added at the 5' end of the primer,
  3. GC clamp: cgcccgccgcgccccgcgcccggcccgccgcccccgcccg