Skip to main content

Table 1 Primer sequences and optimized annealing temperatures for each pair of primers

From: Methylation screening of the TGFBI promoter in human lung and prostate cancer by methylation-specific PCR

Primers Sequence CpG sites Location Length (bp) Annealing temp. (°C)
P1 5' TATGTAGGATCGAAGTTTTC 3' 2 -405 ~ -64 341 60–62
P3 5' GGGTATAGTGCGGGAGC 3' 2 -235 ~ +22 257 65–67
P5 5' GAGGCGTTAGGCGGTTC 3' 3 -180 ~ -26 155 64.5
U1 5' GAGGTGTTAGGTGGTTTGTT 3' 3 -180 ~ +71 252 62