Skip to main content

Table 2 Paired primers used to amplify the specific sequence of ATBF1-A, including the partial mutation loci previously reported in prostate cancer

From: Loss of heterozygosity at the ATBF1-A locus located in the 16q22 minimal region in breast cancer

     Primer sequence (5'→3')  
Exon Mutation no. Nucleotide* Amino acid Forward Reverse Product size (bp)
9 1 (5556–5559) del Frameshift AGCAACCGGTCAGCCAGAAC GGTGGCATCCCTACACTCTCAG 336
  2 5602C→T No change    
  3 (5891–5896) del   CTCCAAGCTCTAACTTACTAAGCCAA AGTTGCAGCAGGGTCTCAGTT 349
  4 5897insCAA Gln1741ins    
  5 6350delAG Frameshift AGCCAGCACCCCGAAAAGA CTTGCCGCAGGAGTCACAC 360
  6 6447delG Frameshift    
  7 7154C→T R2160W CACCGGCCCAGCCATCAGT AACCCGGACTTGTCTGCCATCT 322
  8 8364A→G Gln2564Arg TCAACTCCTCAACAGCTCGCAA GCTTGCACTGGCCTTTTCCTC 333
  9 8919C→T A2749V CGCAGGCCCACAGGAGA CAAAGTCTTCAATCCCTTCCACC 321
  10 9380A→G S2903G AACTCTTCTAAGCCCTTCCTCCAT CACTGTAGTCCACTGTACCTTCATTG 356
  11 9434G→A A2921T CCGAGCTTTTATAGCAAGGAATATG ACTTGGACTTCTTTTCTTTTGCCC 322
10 12 (10814–10834)del 7 amino acid loss TCCTTACTTTGTACCAGGCTTTTCTC TCTTCTGGTTTGGGGGATTCTTTG 345
  13 (10814–10837)del 8 amino acid loss    
  14 (10826–10846)del 7 amino acid loss    
  1. *ATBF1 mutations previously reported in prostate cancer by Sun et al. [10]