Skip to main content

Table 1 CHEK2 Primers and Details

From: Identification of a novel CHEK2variant and assessment of its contribution to the risk of breast cancer in French Canadian women

Fragment Size (bp) Exon Amino Acid Primers (5'->3') Annealing
Temp.(°C)
CHEK2EX01 565 1 1–106 Forward: gaactataggtctgggctgttagg
Reverse: tccacctggtaatacaactttctg
57
CHEK2EX02 582 2&3 107–197 Forward: tgccttcttaggctattttcctac
Reverse: aaccatattctgtaaggacaggac
56
CHEK2EX04 354 4 198–228 Forward: ctcaagggctttacaatatg
Reverse: gaaatgagaaaccaccaatc
54
CHEK2EX05 499 5 229–264 Forward: gaatttcacaatccagggctac
Reverse: ctcacaaattcatccatctaagcag
56
CHEK2EX06 632 6 265–282 Forward: tagagctgggtttggaactcag
Reverse: agctaggcatgtgtgtgaatg
68
CHEK2EX07 434 7 283–304 Forward: aagaagactgggaagagacctagc
Reverse: gcaagcctacattagattctttgg
56
CHEK2EX08 365 8 305–336 Forward: catctcattccttagtttccaactg
Reverse: tctgcctaattcagggagtaattc
56
CHEK2EX09 331 9 337–365 Forward: ctgtgagatgtgtgtgttggtaac
Reverse: tctggataagagcagtatcacctg
58
CHEK2EX10 546 10 366–420 Forward: ttaatttaagcaaaattaaatgtcc
Reverse: ggcatggtggtgtgcatc
54
CHEK2EX11 353 11 421–458 Forward: gctgggattacaagcctaagg
Reverse: gaagaaactcccaccacagc
69
CHEK2EX12 541 12 459–487 Forward: ggcctgttaattctggcatactc
Reverse: aaaggttgtagcctggccag
67
CHEK2EX13 488 13 488–514 Forward: cctctgggaaggtagaggc
Reverse: caatccctagctgtgcttatcg
66
CHEK2EX14 585 14 515–543 Forward: cccccactttactggaagc
Reverse: gcaaaaccctgtctctacaaaat
64
CHEK2 R406H Allele Specific N/A 10 N/A Forward: ggactgctgggtataacca 54
CHEK2 Long Range ~9,200 10–14 366–543 Forward: cgacggccagtctcaagaagaggactgtctt
Reverse: gctatgaccatgcacaaagcccaggttccatc
58
CHEK2 Restriction 546 10 366–420 Forward : ttaatttaagcaaaattaaatgtc Reverse : ggcatggtggtgtgcatc 57
CHEK2 Restriction Nested 202 10 380–420 Forward: catgagaaccttatgtggaaccc
Reverse: cctggacaacagagcaagacacat
58
CHEK2 1100delC Sizing 196 10 366–396 Forward:aatagaaactgatctagcctacgtgt
Reverse: gaacttcaggcgccaagt
60
  1. Summary of primers, annealing termperatures and PCR amplicon sizes for the 14 coding exons of CHEK2. Additional details are listed for primers used for Long Range PCR, R406H and 1100delC genotyping.