Skip to main content

Table 1 Primer sequences and restriction enzymes

From: Modified FOLFOX-6 chemotherapy in advanced gastric cancer: Results of phase II study and comprehensive analysis of polymorphisms as a predictive and prognostic marker

Gene Polymorphisms Location Primer Restriction enzyme References
TS (Ch 18p11.32) 2R or 3R VNTR in ER* ER (5'UTR) Forward: GTGGCTCCTGCGTTTCCCCC   16
    Backward: GCTCCGAGCCGGCCACAGGCATGGCGCGG   
  G/C SNP in 3R 5'UTR Forward:: GTGGCTCCTGCGTTTCCCCC Hae III 19
    Backward: GCTCCGAGCCGGCCACAGGCATGGCGCGG   
  6 bp insertion(+)/deletion(-) 3'UTR Forward: CAAATCTGAGGGAGCTGAGT Dra I 15
    Backward: CAGATAAGTGGCAGTACAGA   
GSTP1 (Ch.11q13) A/G, Ile105Val Exon5 Forward: CTCTATGGGAAGGACCAGCA BsmA I 29
    Backward: TGAGGGCACAAGAAGCCCCT   
ERCC1 (Ch.19q13.2) C/T, Asn118Asn Exon4 Forward: TCATCCCTATTGATGGCTTCTGCCC BsrD I 30
    Backward: GACCATGCCCAGAGGCTTCTCATAG   
  C8092A 3'UTR Forward: CAGAGACAGTGCCCCAAGAG Mbo II 31
    Backward: GGGCACCTTCAGCTTTCTTT   
XPD (Ch.19q13.3) C/A, Arg156Arg Exon6 Forward: CACACCTGGCTCATTTTTGTAT Tfi I 32
    Backward: TCATCCAGGTTGTAGATGCCA   
  G/A, Asp312Asn Exon10 Forward: CTGTTGGTGGGTGCCCGTATCTGTTGGTCT Sty I 33
    Backward: (TAATA)TCGGGGCTCACCCTGCAGCACTTCCT   
  A/C, Lys751Gln Exon23 Forward: GCCCGCTCTGGATTATACG Pst I 33
    Backward: CTATCATCTCCTGGCCCCC   
XRCC (Ch.19q13.2) G/A, Arg399Gln Exon10 Forward: TTGTGCTTTCTCTGTGTCCA Msp I 34
    Backward: TCCTCCAGCCTTTTCTGATA   
  1. Ch, chromosome; VNTR, variable number tandem repeats; UTR, untranslated region; ER, enhancer region; TS, thymidylate synthase; GSTP, glutathione S- transferase π; ERCC1, excision repair cross-complementation 1; XPD, xeroderma pigmentosum group D; XRCC, X-ray repair cross-complementing group.
  2. *VNTR polymorphism is a double repeat (2R) or triple repeat (3R) of 28-bp sequence in TS 5'UTR.
\