Skip to main content

Table 1 Primers and amplification conditions.

From: Methylation alterations are not a major cause of PTTG1 missregulation

Primer Sequence (5'-3') Amplicon Amplification conditions
PTTG MF1 TTTCGGATTGTTAATTGGATTAAC 168 bp 1. [95°C for 7'] 2. [95°C for 0'', 60°C for 20'', 72°C for 25 '']x45 3. Melting curve
PTTG MR1 AAAAACAAAAACTAAACAACGAA   2. [95°C for 0'', 60°C for 20'', 72°C for 25 ''] × 45
PTTG UF1 TTGGATTGTTAATTGGATTAATGG 166 bp 3. Melting curve
PTTG UR1 AAAAACAAAAACTAAACAACAAA   
PTTG MF2 GTTTTATTTGGTGATTACGTTTACG 123 bp 1. [95°C for 7']
PTTG MR2 ACCGCATTCATCTAAAACCG   2. [95°C for 0'', 60°C for 20'', 72°C for 25 ''] × 45
PTTG UF2 TTTTATTTGGTGATTATGTTTATGG 125 bp 3. Melting curve
PTTG UR2 ACAACCACATTCATCTAAAACCAC   
PTTG-1F AAAGTAGCTACCATTCCTGC 124 bp 1. [95°C for 7'] 2. [95°C for 30'', 60°C for 30'', 72°C for 30 '']x45 3. [72°C for 3']
PTTG-1R TGCCCTGTAAAAGCAAAAT   2. [95°C for 30'', 60°C for 30'', 72°C for 30 ''] × 45
PTTG-1 Anc FL-AATAGCCCAACATAATAGAATCTATTTT-Ph   3. [72°C for 3']
PTTG-1 Sen GCTACCATTCCTGCCTTAATA-Cy5   
PTTG-3F TGCTGACAGGTGCTGGTACT 128 bp 1. [95°C for 7'] 2. [95°C for 30'', 60°C for 30'', 72°C for 30 '']x45 3. [72°C for 3']
PTTG-3R AAGAAGCCATAATCCTTAGTTTTCA   2. [95°C for 30'', 60°C for 30'', 72°C for 30 ''] × 45
PTTG-3 Anc FL-TTTGAGTCATGCTACTCGAATTACAT-Ph   3. [72°C for 3']
PTTG-3 Sen GGTACTTAAATTTCCGATTTTAAC-Cy5   
p16 Forward outer GTAGGTGGGGAGGAGTTTAGTT 283 bp 1. [94°C for 3']
p16 Reverse outer TCTAATAACCAACCAACCCCTCC   2. [94°C for 30'', 50°C for 30'', 72°C for 30''] × 20
3.[72°C for 4']
p16 Forward inner GGGGGAGATTTAATTTGG 190 bp 1. [94°C for 3'] 2. [94°C for 30'', 50°C for 30'', 72°C for 30''] × 30 3. [72°C for 4']
p16 Reverse inner CCCTCCTCTTTCTTCCTC   2. [94°C for 30'', 50°C for 30'', 72°C for 30''] × 30
3. [72°C for 4']
qPCR PTTG Fw AGGCACCCGTGTGGTTGCT 126 bp 1. [50°C for 2']
qPCR PTTG Rev TAAGGCTGGTGGGGCATC   2. [95°C for 2']
qPCR RPL13A Fw CCTGGAGGAGAAGAGGAAAGAGA 125 bp 3. [95°C for 5'', 60°C for 30''] × 40
qPCR RPL13A Rev TTGAGGACCTCTGTGTATTTGTCAA   4. Melting curve